Browse papers
LevelBSc CSIT (TU)
StreamScience
SubjectB.Sc. Mathematics 407 & 408 (Model)
Year2079 BS
Exam sessionModel questions
Full marks100
Time allowed180 minutes
Questions20, all with step-by-step solutions
A

MAT 407 - Bio Mathematics

Attempt all questions. Full Marks: 100, Pass Marks: 35, Time: 3 Hours.

10 questions·10 marks each
407.1Long answer10 marks

(a) The population of elephants in Chitwan National Park is 200, find the population after 5 years, if the growth rate is 5% per year. [5]

(b) In the model ΔP=1.3P(1P10)\Delta P = 1.3\,P\left(1 - \dfrac{P}{10}\right), what values of PP will cause ΔP\Delta P to be positive? Negative? Why does this matter biologically? [5]

(a) With a constant per-year growth rate of 5%5\%, the population follows geometric growth Pt=P0(1+r)tP_t = P_0(1+r)^t with P0=200P_0 = 200, r=0.05r = 0.05, t=5t = 5.

P5=200(1.05)5=200×1.2762815625255.26.P_5 = 200\,(1.05)^5 = 200 \times 1.2762815625 \approx 255.26.

So after 5 years the population is approximately 255 elephants.

(b) The model is ΔP=1.3P(1P10)\Delta P = 1.3\,P\left(1 - \dfrac{P}{10}\right).

  • ΔP>0\Delta P > 0 (population grows) when P(1P10)>0P\left(1 - \frac{P}{10}\right) > 0, i.e. for 0<P<100 < P < 10.
  • ΔP<0\Delta P < 0 (population declines) when P>10P > 10 (or P<0P < 0, which is not biologically meaningful).
  • ΔP=0\Delta P = 0 at P=0P = 0 and P=10P = 10, the equilibria.

Biological significance: K=10K = 10 is the carrying capacity. Below it the environment supports growth; above it resources are insufficient and the population shrinks back toward KK. Thus the population self-regulates toward the stable equilibrium P=10P = 10.

population-growthexponential-growthdifference-equations
407.2Long answer10 marks

(a) What are the equilibrium points of Pt+1=Pt+0.7Pt(1Pt10)P_{t+1} = P_t + 0.7\,P_t\left(1 - \dfrac{P_t}{10}\right) and discuss their stability. [5]

(b) Solve the logistic differential equation dNdt=rN[1NK],N(0)=N0\dfrac{dN}{dt} = rN\left[1 - \dfrac{N}{K}\right],\quad N(0) = N_0. [5]

(a) Equilibria satisfy P=P+0.7P(1P10)P^* = P^* + 0.7\,P^*\left(1 - \frac{P^*}{10}\right), i.e. 0.7P(1P10)=00.7\,P^*\left(1 - \frac{P^*}{10}\right) = 0, giving P=0P^* = 0 and P=10P^* = 10.

Let f(P)=P+0.7P(1P10)=1.7P0.07P2f(P) = P + 0.7P\left(1 - \frac{P}{10}\right) = 1.7P - 0.07P^2. Then f(P)=1.70.14Pf'(P) = 1.7 - 0.14P.

  • At P=0P^* = 0: f(0)=1.7f'(0) = 1.7, f>1|f'| > 1unstable.
  • At P=10P^* = 10: f(10)=1.71.4=0.3f'(10) = 1.7 - 1.4 = 0.3, f=0.3<1|f'| = 0.3 < 1stable.

So the population converges to the carrying capacity P=10P^* = 10.

(b) Separate variables:

dNN(1NK)=rdt.\frac{dN}{N\left(1 - \frac{N}{K}\right)} = r\,dt.

Using partial fractions 1N(1N/K)=1N+1/K1N/K\dfrac{1}{N(1 - N/K)} = \dfrac{1}{N} + \dfrac{1/K}{1 - N/K}, integrating gives

lnNKN=rt+C.\ln\frac{N}{K - N} = rt + C.

Applying N(0)=N0N(0) = N_0 yields the logistic solution

N(t)=KN0ertK+N0(ert1)=K1+(KN0N0)ert.N(t) = \frac{K N_0 e^{rt}}{K + N_0\left(e^{rt} - 1\right)} = \frac{K}{1 + \left(\frac{K - N_0}{N_0}\right)e^{-rt}}.

As tt \to \infty, N(t)KN(t) \to K.

equilibrium-stabilitylogistic-modeldifference-equations
407.3Long answer10 marks

In a study of insect population, the individuals progress from egg to larva over one step, and larva to adult over another. Finally, adults lay eggs and die in one more time step. Formulate the problem, for which 4% of the eggs survive to become larva, only 39% of the larva make to adulthood, and adults on average produce 73 eggs each. If EtE_t, LtL_t and AtA_t represent the number of eggs, number of larvae and the number of adults respectively,

(a) prove that At+1=(0.39)(0.04)(73)At=1.1388AtA_{t+1} = (0.39)(0.04)(73)A_t = 1.1388\,A_t. [4]

(b) Express the model in the form xt+1=Pxtx_{t+1} = P\,x_t. [4+2]

Formulation. The stage transitions over one time step are:

Et+1=73At,Lt+1=0.04Et,At+1=0.39Lt.E_{t+1} = 73\,A_t,\qquad L_{t+1} = 0.04\,E_t,\qquad A_{t+1} = 0.39\,L_t.

(a) Stepping forward,

At+1=0.39Lt=0.39(0.04Et1)=0.39(0.04)(73At2).A_{t+1} = 0.39\,L_t = 0.39\,(0.04\,E_{t-1}) = 0.39(0.04)(73\,A_{t-2}).

When the cohort moves through all three stages, the net per-generation reproduction is

At+1=(0.39)(0.04)(73)At=1.1388At.A_{t+1} = (0.39)(0.04)(73)\,A_t = 1.1388\,A_t.

Since 1.1388>11.1388 > 1, the adult population grows about 13.88%13.88\% each generation.

(b) Writing the state vector xt=[EtLtAt]x_t = \begin{bmatrix} E_t \\ L_t \\ A_t \end{bmatrix}, the model is xt+1=Pxtx_{t+1} = P\,x_t with projection matrix

P=[00730.040000.390].P = \begin{bmatrix} 0 & 0 & 73 \\ 0.04 & 0 & 0 \\ 0 & 0.39 & 0 \end{bmatrix}.

The dominant eigenvalue of PP gives the long-term growth rate of the population.

matrix-modelinsect-populationleslie-matrix
407.4Long answer10 marks

For the matrix

P=[0.99250.01250.00750.9875]P = \begin{bmatrix} 0.9925 & 0.0125 \\ 0.0075 & 0.9875 \end{bmatrix}

find eigenvalues and eigenvectors.

Eigenvalues. Solve det(PλI)=0\det(P - \lambda I) = 0:

(0.9925λ)(0.9875λ)(0.0125)(0.0075)=0.(0.9925 - \lambda)(0.9875 - \lambda) - (0.0125)(0.0075) = 0.

For a column-stochastic-type matrix the trace is 0.9925+0.9875=1.980.9925 + 0.9875 = 1.98 and the determinant is

detP=(0.9925)(0.9875)(0.0125)(0.0075)=0.980106250.00009375=0.9800125.\det P = (0.9925)(0.9875) - (0.0125)(0.0075) = 0.98010625 - 0.00009375 = 0.9800125.

The characteristic equation is λ21.98λ+0.9800125=0\lambda^2 - 1.98\lambda + 0.9800125 = 0, giving

λ=1.98±1.9824(0.9800125)2=1.98±3.92043.920052=1.98±0.01872.\lambda = \frac{1.98 \pm \sqrt{1.98^2 - 4(0.9800125)}}{2} = \frac{1.98 \pm \sqrt{3.9204 - 3.92005}}{2} = \frac{1.98 \pm 0.0187}{2}.

Thus λ1=1\lambda_1 = 1 and λ2=0.98\lambda_2 = 0.98.

Eigenvectors.

For λ1=1\lambda_1 = 1: (PI)v=00.0075v1+0.0125v2=0v1=0.01250.0075v2=53v2(P - I)v = 0 \Rightarrow -0.0075\,v_1 + 0.0125\,v_2 = 0 \Rightarrow v_1 = \frac{0.0125}{0.0075}v_2 = \frac{5}{3}v_2. Taking v2=3v_2 = 3, v1=5v_1 = 5:

v(1)=[53] (or normalized [0.625,0.375]T).v^{(1)} = \begin{bmatrix} 5 \\ 3 \end{bmatrix}\ (\text{or normalized } [0.625,\,0.375]^T).

For λ2=0.98\lambda_2 = 0.98: (P0.98I)v=00.0125v1+0.0125v2=0v1=v2(P - 0.98 I)v = 0 \Rightarrow 0.0125\,v_1 + 0.0125\,v_2 = 0 \Rightarrow v_1 = -v_2:

v(2)=[11].v^{(2)} = \begin{bmatrix} 1 \\ -1 \end{bmatrix}.
eigenvalueseigenvectorsmatrix-algebra
407.5Long answer10 marks

Derive the predator-prey model:

Pt+1=Pt+rPt(1PtK)sPtQt,P_{t+1} = P_t + rP_t\left(1 - \dfrac{P_t}{K}\right) - sP_tQ_t, Qt+1=QtuQt+vPtQtQ_{t+1} = Q_t - uQ_t + vP_tQ_t

where r,s,u,v,Kr, s, u, v, K are positive constants and u<1u < 1, and all the symbols have their usual meanings. Find their equilibrium points. [6+4]

Or

For the predator-prey model

Pt+1=Pt(1+1.3(1Pt))0.5PtQt,P_{t+1} = P_t\left(1 + 1.3(1 - P_t)\right) - 0.5P_tQ_t, Qt+1=0.3Qt+1.6PtQtQ_{t+1} = 0.3Q_t + 1.6P_tQ_t

(a) compute the Jacobian matrix. (b) Evaluate the Jacobian matrix at the equilibrium points. [4+6]

Derivation. The prey PP grows logistically rPt(1Pt/K)rP_t(1 - P_t/K) but is reduced by predation proportional to encounters sPtQtsP_tQ_t. Predators QQ die at rate uu (uQt-uQ_t) but reproduce in proportion to prey consumed vPtQtvP_tQ_t. This gives the coupled system stated.

Equilibria (P,Q)(P^*, Q^*) satisfy ΔP=0\Delta P = 0 and ΔQ=0\Delta Q = 0:

rP(1PK)sPQ=0,uQ+vPQ=0.rP^*\left(1 - \frac{P^*}{K}\right) - sP^*Q^* = 0,\qquad -uQ^* + vP^*Q^* = 0.

From the second equation: Q=0Q^* = 0 or P=u/vP^* = u/v.

  • Trivial: (0,0)(0,0).
  • Prey-only: Q=0P=KQ^* = 0 \Rightarrow P^* = K, giving (K,0)(K, 0).
  • Coexistence: P=u/vP^* = u/v, substitute into the first: r(1uvK)=sQQ=rs(1uvK)r\left(1 - \frac{u}{vK}\right) = sQ^* \Rightarrow Q^* = \frac{r}{s}\left(1 - \frac{u}{vK}\right), giving (uv, rs(1uvK))\left(\dfrac{u}{v},\ \dfrac{r}{s}\left(1 - \dfrac{u}{vK}\right)\right).

OR (specific model). Let f(P,Q)=P(1+1.3(1P))0.5PQ=2.3P1.3P20.5PQf(P,Q) = P(1 + 1.3(1 - P)) - 0.5PQ = 2.3P - 1.3P^2 - 0.5PQ and g(P,Q)=0.3Q+1.6PQg(P,Q) = 0.3Q + 1.6PQ.

(a) Jacobian

J=[fPfQgPgQ]=[2.32.6P0.5Q0.5P1.6Q0.3+1.6P].J = \begin{bmatrix} \dfrac{\partial f}{\partial P} & \dfrac{\partial f}{\partial Q} \\[4pt] \dfrac{\partial g}{\partial P} & \dfrac{\partial g}{\partial Q} \end{bmatrix} = \begin{bmatrix} 2.3 - 2.6P - 0.5Q & -0.5P \\ 1.6Q & 0.3 + 1.6P \end{bmatrix}.

(b) Equilibria: g=0Q=0g=0 \Rightarrow Q=0 or P=(10.3)/1.6=0.4375P = (1-0.3)/1.6 = 0.4375.

  • At (0,0)(0,0): J=[2.3000.3]J = \begin{bmatrix} 2.3 & 0 \\ 0 & 0.3 \end{bmatrix}.
  • Prey-only f=0, Q=02.31.3P=0P=1.0f=0,\ Q=0 \Rightarrow 2.3 - 1.3P = 0 \Rightarrow P = 1.0: at (1,0)(1,0), J=[2.32.60.500.3+1.6]=[0.30.501.9]J = \begin{bmatrix} 2.3 - 2.6 & -0.5 \\ 0 & 0.3 + 1.6 \end{bmatrix} = \begin{bmatrix} -0.3 & -0.5 \\ 0 & 1.9 \end{bmatrix}.
  • Coexistence P=0.4375P = 0.4375, f=02.31.3(0.4375)0.5Q=0Q=(2.30.56875)/0.5=3.4625f=0 \Rightarrow 2.3 - 1.3(0.4375) - 0.5Q = 0 \Rightarrow Q = (2.3 - 0.56875)/0.5 = 3.4625: at (0.4375,3.4625)(0.4375, 3.4625), J=[2.32.6(0.4375)0.5(3.4625)0.5(0.4375)1.6(3.4625)0.3+1.6(0.4375)]=[0.868750.218755.541.0].J = \begin{bmatrix} 2.3 - 2.6(0.4375) - 0.5(3.4625) & -0.5(0.4375) \\ 1.6(3.4625) & 0.3 + 1.6(0.4375) \end{bmatrix} = \begin{bmatrix} -0.86875 & -0.21875 \\ 5.54 & 1.0 \end{bmatrix}.
predator-preyequilibriumjacobian
407.6Long answer10 marks

Consider the 20-base sequence AGGGATACATGACCCATACAAGGGATACATGACCCATACA.

(a) Use the first five bases to estimate the four probabilities pAp_A, pGp_G, pCp_C, and pTp_T.

(b) Repeat part (a) using the first 10 bases.

(c) Repeat part (a) using all the bases. [10]

The sequence is AGGGATACATGACCCATACAA\,G\,G\,G\,A\,T\,A\,C\,A\,T\,G\,A\,C\,C\,C\,A\,T\,A\,C\,A.

(a) First 5 bases: AGGGAAGGGA — counts A=2, G=3, C=0, T=0A=2,\ G=3,\ C=0,\ T=0.

pA=25=0.40,pG=35=0.60,pC=0,pT=0.p_A = \tfrac{2}{5} = 0.40,\quad p_G = \tfrac{3}{5} = 0.60,\quad p_C = 0,\quad p_T = 0.

(b) First 10 bases: AGGGATACATAGGGATACAT — counts A=4, G=3, C=1, T=2A=4,\ G=3,\ C=1,\ T=2.

pA=0.40,pG=0.30,pC=0.10,pT=0.20.p_A = 0.40,\quad p_G = 0.30,\quad p_C = 0.10,\quad p_T = 0.20.

(c) All 20 bases — counts A=8, G=3, C=5, T=4A=8,\ G=3,\ C=5,\ T=4 (sum =20= 20).

pA=820=0.40,pG=320=0.15,pC=520=0.25,pT=420=0.20.p_A = \tfrac{8}{20} = 0.40,\quad p_G = \tfrac{3}{20} = 0.15,\quad p_C = \tfrac{5}{20} = 0.25,\quad p_T = \tfrac{4}{20} = 0.20.

The estimates stabilize as the sample (sequence length) increases, illustrating that larger samples give more reliable frequency estimates.

dna-sequenceprobabilitybase-frequency
407.7Long answer10 marks

For nn terminal taxa, the number of unrooted bifurcating trees is

135(2n5)=(2n5)!2n3(n3)!.1 \cdot 3 \cdot 5 \cdots (2n-5) = \frac{(2n-5)!}{2^{n-3}(n-3)!}.

Make a table of values and graph this function for n10n \le 10. [10]

Let T(n)T(n) be the number of unrooted bifurcating trees for nn taxa (defined for n3n \ge 3). Using T(n)=(2n5)!!=135(2n5)T(n) = (2n-5)!! = 1\cdot 3\cdot 5\cdots(2n-5):

nn2n52n-5T(n)=(2n5)!!T(n) = (2n-5)!!
311
433
5515
67105
79945
81110,395
913135,135
10152,027,025

Graph: plotting T(n)T(n) against nn gives a super-exponentially increasing curve (each value multiplied by the next odd number). Because the growth is so steep, a log\log-scale plot of lnT(n)\ln T(n) vs nn is clearer and is approximately linear-to-convex, showing that the number of possible tree topologies explodes combinatorially — by n=10n = 10 there are already over 2 million unrooted trees.

phylogeneticscombinatoricstree-counting
407.8Long answer10 marks

Find the probability that the progeny of DdWw×ddWwDdWw \times ddWw is dwarf with round seeds. [10]

Or

Assuming births of each sex are equally likely, a two-child family may have 4 outcomes in the sexes of the children. (a) List the outcomes and give the probability of each. (b) What is the probability that at least one child is a female? (c) What is the probability that the youngest child is a female? (d) What is the conditional probability that the youngest child is a female, given that at least one child is a female? (e) What is the conditional probability that at least one child is a female, given that the youngest child is a female?

Genetics cross DdWw×ddWwDdWw \times ddWw. Treat the two genes independently. Assume DD (tall) is dominant over dd (dwarf), and WW (round) dominant over ww (wrinkled); 'dwarf' = dddd, 'round' = W_W\_.

  • Height: Dd×dd12Dd:12ddDd \times dd \Rightarrow \tfrac12\,Dd : \tfrac12\,dd. So P(dwarf,dd)=12P(\text{dwarf}, dd) = \tfrac12.
  • Seed: Ww×Ww14WW:12Ww:14wwWw \times Ww \Rightarrow \tfrac14\,WW : \tfrac12\,Ww : \tfrac14\,ww. So P(round,W_)=34P(\text{round}, W\_) = \tfrac34.

By independence,

P(dwarf and round)=12×34=38=0.375.P(\text{dwarf and round}) = \frac12 \times \frac34 = \frac{3}{8} = 0.375.

OR (two-child family).

(a) Outcomes (eldest, youngest), each with probability 14\tfrac14: {BB, BG, GB, GG}\{BB,\ BG,\ GB,\ GG\}.

(b) P(at least one female)=1P(BB)=114=34P(\text{at least one female}) = 1 - P(BB) = 1 - \tfrac14 = \tfrac34.

(c) P(youngest is female)=P({BG,GG})=12P(\text{youngest is female}) = P(\{BG, GG\}) = \tfrac12.

(d) P(youngest Fat least one F)=P(youngest F)P(at least one F)=1/23/4=23.P(\text{youngest F} \mid \text{at least one F}) = \dfrac{P(\text{youngest F})}{P(\text{at least one F})} = \dfrac{1/2}{3/4} = \dfrac{2}{3}.

(e) P(at least one Fyoungest F)=P(youngest F)P(youngest F)=1P(\text{at least one F} \mid \text{youngest F}) = \dfrac{P(\text{youngest F})}{P(\text{youngest F})} = 1 (if the youngest is female there is certainly at least one female).

geneticsmendelian-inheritanceprobability
407.9Long answer10 marks

Derive the SIR model. Find the threshold value. [5+5]

Or

Derive SI and SIS models. Solve for all equilibria (S,I)(S^*, I^*). [7+3]

SIR model. Partition the population N=S+I+RN = S + I + R into Susceptible, Infected, Removed. With transmission rate β\beta and recovery rate γ\gamma:

dSdt=βSI,dIdt=βSIγI,dRdt=γI.\frac{dS}{dt} = -\beta SI,\qquad \frac{dI}{dt} = \beta SI - \gamma I,\qquad \frac{dR}{dt} = \gamma I.

Threshold. An epidemic grows only if dIdt>0\dfrac{dI}{dt} > 0 initially, i.e. βS0γ>0S0>γβ\beta S_0 - \gamma > 0 \Rightarrow S_0 > \dfrac{\gamma}{\beta}. Defining the basic reproduction number

R0=βS0γ,R_0 = \frac{\beta S_0}{\gamma},

an epidemic occurs iff R0>1R_0 > 1; the threshold susceptible level is S=γ/βS^* = \gamma/\beta (the relative removal rate ρ=γ/β\rho = \gamma/\beta).

OR — SI and SIS models.

SI model (no recovery), N=S+IN = S + I:

dIdt=βSI=β(NI)I.\frac{dI}{dt} = \beta SI = \beta(N - I)I.

Equilibria: I=0I^* = 0 (disease-free, S=NS^* = N) and I=NI^* = N (endemic, S=0S^* = 0). With I(0)>0I(0) > 0 the disease grows logistically to I=NI^* = N.

SIS model (infected return to susceptible at rate γ\gamma):

dIdt=β(NI)IγI.\frac{dI}{dt} = \beta(N - I)I - \gamma I.

Set =0=0: I[β(NI)γ]=0I^*\left[\beta(N - I^*) - \gamma\right] = 0, so

I=0 (disease-free, S=N),I=Nγβ (S=γβ).I^* = 0\ (\text{disease-free},\ S^* = N),\qquad I^* = N - \frac{\gamma}{\beta}\ \left(S^* = \frac{\gamma}{\beta}\right).

The endemic equilibrium is positive (and stable) iff R0=βN/γ>1R_0 = \beta N/\gamma > 1.

epidemiologysir-modeldifferential-equations
407.10Long answer10 marks

Plot the three points (1,1)(1, 1), (0,3)(0, 3), and (1,4)(1, 4). Then, find the least squares, best-fit line for them. Draw a graph of the line to your plot. [10]

Or

Drug levels in the bloodstream are typically observed to decay exponentially with time from the administration of a dose. A difference equation model is, with tt (day) and yy (mg/l): (0,200),(1,129),(3,58),(4,33)(0,200),(1,129),(3,58),(4,33), given by yt+1=(1r)yty_{t+1} = (1 - r)y_t, where rr is the percentage of the drug absorbed/metabolized during one time step. (a) If the initial amount is y0y_0, explain why this model leads to yt=y0(1r)ty_t = y_0(1 - r)^t. (b) Letting k=ln(1r)k = \ln(1 - r) and a=y0a = y_0, show this is equivalent to yt=aekty_t = ae^{kt}. (c) Explain why 0<r<10 < r < 1 for this model, and then why k<0k < 0. [10]

Least-squares line for (1,1),(0,3),(1,4)(1,1),(0,3),(1,4). Let the line be y=mx+by = mx + b. With x={1,0,1}x = \{1,0,1\}, y={1,3,4}y = \{1,3,4\}: n=3n = 3, x=2\sum x = 2, y=8\sum y = 8, xy=(1)(1)+(0)(3)+(1)(4)=5\sum xy = (1)(1)+(0)(3)+(1)(4) = 5, x2=2\sum x^2 = 2.

m=nxyxynx2(x)2=3(5)(2)(8)3(2)22=151664=12.m = \frac{n\sum xy - \sum x \sum y}{n\sum x^2 - (\sum x)^2} = \frac{3(5) - (2)(8)}{3(2) - 2^2} = \frac{15 - 16}{6 - 4} = -\frac12. b=ymxn=8(12)(2)3=8+13=3.b = \frac{\sum y - m\sum x}{n} = \frac{8 - (-\tfrac12)(2)}{3} = \frac{8 + 1}{3} = 3.

Best-fit line: y=12x+3\boxed{y = -\tfrac12 x + 3}. The plot shows the three points with this line passing through (0,3)(0,3) with slope 12-\tfrac12.

OR — exponential drug decay.

(a) Iterating yt+1=(1r)yty_{t+1} = (1-r)y_t from y0y_0: y1=(1r)y0y_1 = (1-r)y_0, y2=(1r)y1=(1r)2y0y_2 = (1-r)y_1 = (1-r)^2 y_0, and by induction yt=y0(1r)ty_t = y_0(1-r)^t.

(b) With k=ln(1r)k = \ln(1-r), we have 1r=ek1 - r = e^{k}, so (1r)t=ekt(1-r)^t = e^{kt}. Hence yt=y0ekt=aekty_t = y_0 e^{kt} = a e^{kt} with a=y0a = y_0.

(c) Since rr is the fraction of drug removed per step, the amount removed cannot exceed the amount present (r1r \le 1) and must be positive for decay (r>0r > 0), so 0<r<10 < r < 1. Then 0<1r<10 < 1 - r < 1, and the logarithm of a number in (0,1)(0,1) is negative, so k=ln(1r)<0k = \ln(1-r) < 0 — confirming exponential decay.

least-squaresregressionexponential-decay
B

MAT 408 - Mathematical Economics

Attempt ALL the questions. Full Marks: 100, Pass Marks: 35, Time: 3 Hrs.

10 questions·10 marks each
408.1Long answer10 marks

(a) Define market equilibrium. Write a two-commodity market model and extract the equilibrium condition of the model. [1+5]

(b) Extract the equilibrium solution of the following model. [4]

Qd1=102P12P1+P2,Qs1=2+3P1,Q_{d1} = 10 - 2P_1 - 2P_1 + P_2,\quad Q_{s1} = -2 + 3P_1, Qd2=15+P12P1P2,Qs2=1.Q_{d2} = 15 + P_1 - 2P_1 - P_2,\quad Q_{s2} = -1.

(a) Market equilibrium is the state in which the quantity demanded equals the quantity supplied for each commodity, so there is no tendency for price to change (Qd=QsQ_d = Q_s).

A two-commodity market model with linear demand/supply:

Qd1=a0+a1P1+a2P2,Qs1=b0+b1P1+b2P2,Q_{d1} = a_0 + a_1 P_1 + a_2 P_2,\quad Q_{s1} = b_0 + b_1 P_1 + b_2 P_2, Qd2=α0+α1P1+α2P2,Qs2=β0+β1P1+β2P2.Q_{d2} = \alpha_0 + \alpha_1 P_1 + \alpha_2 P_2,\quad Q_{s2} = \beta_0 + \beta_1 P_1 + \beta_2 P_2.

Equilibrium requires Qd1=Qs1Q_{d1} = Q_{s1} and Qd2=Qs2Q_{d2} = Q_{s2}, i.e. the excess-demand equations

(a0b0)+(a1b1)P1+(a2b2)P2=0,(a_0 - b_0) + (a_1 - b_1)P_1 + (a_2 - b_2)P_2 = 0, (α0β0)+(α1β1)P1+(α2β2)P2=0,(\alpha_0 - \beta_0) + (\alpha_1 - \beta_1)P_1 + (\alpha_2 - \beta_2)P_2 = 0,

solved simultaneously for P1,P2P_1^*, P_2^* (then Q1,Q2Q_1^*, Q_2^*).

(b) Taking the model literally (combining like terms):

  • Commodity 1: Qd1=104P1+P2Q_{d1} = 10 - 4P_1 + P_2. Set Qd1=Qs1Q_{d1} = Q_{s1}: 104P1+P2=2+3P17P1P2=1210 - 4P_1 + P_2 = -2 + 3P_1 \Rightarrow 7P_1 - P_2 = 12. …(i)
  • Commodity 2: Qd2=15P1P2Q_{d2} = 15 - P_1 - P_2. Set Qd2=Qs2=1Q_{d2} = Q_{s2} = -1: 15P1P2=1P1+P2=1615 - P_1 - P_2 = -1 \Rightarrow P_1 + P_2 = 16. …(ii)

Add (i) and (ii): 8P1=28P1=3.58P_1 = 28 \Rightarrow P_1^* = 3.5. Then P2=163.5=12.5P_2^* = 16 - 3.5 = 12.5.

Equilibrium quantities: Q1=2+3(3.5)=8.5Q_1^* = -2 + 3(3.5) = 8.5; Q2=1Q_2^* = -1.

(The model as printed yields Qs2=1Q_{s2} = -1, a negative quantity, suggesting a typo in the source; method shown is the standard solution procedure.)

market-equilibriumtwo-commodity-modellinear-algebra
408.2Long answer10 marks

Consider the situation of a mass layoff where 1200 people become unemployed and now begin a job search. There are two states: employed (EE) and unemployed (UU) with an initial vector x0=[E U]=[0 1200]x_0 = [E\ U] = [0\ 1200]. Suppose that in any given period an unemployed person will find a job with probability 0.70.7. Additionally, people who are employed in any given period may lose their job with probability 0.10.1.

(a) Set up the Markov transition matrix for this problem. (b) What will be the number of unemployed people after (i) 2 periods; (ii) 10 periods? (c) What is the steady-state level of unemployment? [5+4+1]

(a) States {E,U}\{E, U\}. An unemployed person finds a job with prob 0.70.7 (stays unemployed 0.30.3); an employed person loses the job with prob 0.10.1 (stays employed 0.90.9). With row vector convention xt+1=xtPx_{t+1} = x_t P:

P=[P(EE)P(EU)P(UE)P(UU)]=[0.90.10.70.3].P = \begin{bmatrix} P(E\to E) & P(E\to U) \\ P(U\to E) & P(U\to U) \end{bmatrix} = \begin{bmatrix} 0.9 & 0.1 \\ 0.7 & 0.3 \end{bmatrix}.

(b) Start x0=[0, 1200]x_0 = [0,\ 1200].

  • x1=x0P=[0(0.9)+1200(0.7), 0(0.1)+1200(0.3)]=[840, 360]x_1 = x_0 P = [0(0.9)+1200(0.7),\ 0(0.1)+1200(0.3)] = [840,\ 360].
  • x2=x1P=[840(0.9)+360(0.7), 840(0.1)+360(0.3)]=[756+252, 84+108]=[1008, 192]x_2 = x_1 P = [840(0.9)+360(0.7),\ 840(0.1)+360(0.3)] = [756+252,\ 84+108] = [1008,\ 192].
    • After 2 periods: 192 unemployed.
  • Iterating toward the steady state, after 10 periods the distribution is essentially at steady state. Numerically x10[1050, 150]x_{10} \approx [1050,\ 150], so about 150 unemployed after 10 periods.

(c) Steady state π=πP\pi = \pi P with πE+πU=1200\pi_E + \pi_U = 1200. From πU=0.1πE+0.3πU0.7πU=0.1πEπE=7πU\pi_U = 0.1\pi_E + 0.3\pi_U \Rightarrow 0.7\pi_U = 0.1\pi_E \Rightarrow \pi_E = 7\pi_U. With πE+πU=1200\pi_E + \pi_U = 1200: 8πU=1200πU=1508\pi_U = 1200 \Rightarrow \pi_U = 150, πE=1050\pi_E = 1050.

Steady-state unemployment = 150 people (i.e. 12.5%12.5\%).

markov-chainstransition-matrixsteady-state
408.3Long answer10 marks

(a) Define marginal-cost and average-cost. Given the total-cost function C=Q35Q2+12Q+75C = Q^3 - 5Q^2 + 12Q + 75, write out a variable-cost (VC) function. Find the derivative of the VC function and interpret the economic meaning of the derivative.

(b) Write the economic interpretation of partial derivatives. Use Jacobian determinants to test the existence of functional dependence between the following paired functions. [5+5]

y1=3x12+x2;y2=9x14+6x12(x2+4)+x2(x2+8)+12.y_1 = 3x_1^2 + x_2;\quad y_2 = 9x_1^4 + 6x_1^2(x_2 + 4) + x_2(x_2 + 8) + 12.

(a) Marginal cost (MC) is the rate of change of total cost with respect to output, MC=dCdQMC = \dfrac{dC}{dQ}. Average cost (AC) is total cost per unit of output, AC=CQAC = \dfrac{C}{Q}.

For C=Q35Q2+12Q+75C = Q^3 - 5Q^2 + 12Q + 75, the constant 7575 is fixed cost, so the variable cost is

VC=Q35Q2+12Q.VC = Q^3 - 5Q^2 + 12Q.

Its derivative is

d(VC)dQ=3Q210Q+12,\frac{d(VC)}{dQ} = 3Q^2 - 10Q + 12,

which equals the marginal cost (since fixed cost has zero derivative). Economically it measures the additional cost of producing one more unit of output at the given level of QQ.

(b) A partial derivative y/xi\partial y/\partial x_i measures the rate of change of yy with respect to xix_i holding the other variables constant — the marginal effect of that variable.

Jacobian test for functional dependence.

y1x1=6x1,y1x2=1,\frac{\partial y_1}{\partial x_1} = 6x_1,\quad \frac{\partial y_1}{\partial x_2} = 1, y2x1=36x13+12x1(x2+4)=36x13+12x1x2+48x1,\frac{\partial y_2}{\partial x_1} = 36x_1^3 + 12x_1(x_2 + 4) = 36x_1^3 + 12x_1 x_2 + 48x_1, y2x2=6x12+2x2+8.\frac{\partial y_2}{\partial x_2} = 6x_1^2 + 2x_2 + 8.

Jacobian:

J=6x1136x13+12x1x2+48x16x12+2x2+8.|J| = \begin{vmatrix} 6x_1 & 1 \\ 36x_1^3 + 12x_1 x_2 + 48x_1 & 6x_1^2 + 2x_2 + 8 \end{vmatrix}. =6x1(6x12+2x2+8)(36x13+12x1x2+48x1)= 6x_1(6x_1^2 + 2x_2 + 8) - (36x_1^3 + 12x_1 x_2 + 48x_1) =36x13+12x1x2+48x136x1312x1x248x1=0.= 36x_1^3 + 12x_1 x_2 + 48x_1 - 36x_1^3 - 12x_1 x_2 - 48x_1 = 0.

Since J0|J| \equiv 0 identically, the functions are functionally dependent. Indeed y2=(3x12+x2)2+8(3x12+x2)+12=y12+8y1+12y_2 = (3x_1^2 + x_2)^2 + 8(3x_1^2 + x_2) + 12 = y_1^2 + 8y_1 + 12.

marginal-costderivativesjacobian-determinant
408.4Long answer10 marks

What are the main assumptions of the IS-LM national-income model? Derive the slope of IS and LM curves, write the equilibrium identities of the curves. Hence, find the comparative-static derivatives of the model. [1+3+2+4]

OR

Define differentials and point elasticity. Let the equilibrium condition for national income be S(Y)+T(Y)=I(Y)+G0S(Y) + T(Y) = I(Y) + G_0 (S,T,I>0S', T', I' > 0; S+T>IS' + T' > I') where S,Y,T,I,GS, Y, T, I, G stand for saving, national income, taxes, investment, and government expenditure. (a) Interpret the economic meaning of the derivatives SS', TT', and II'. (b) Check whether the conditions of the implicit-function theorem are satisfied. If so, write the equilibrium identity. (c) Find dYdG0\dfrac{dY^*}{dG_0} and discuss its economic implications. [2+5+3]

IS-LM model.

Assumptions: prices fixed (short run), two markets — goods (IS) and money (LM); income and interest rate (Y,iY, i) adjust to clear both simultaneously.

IS curve (goods-market equilibrium Y=C(Y)+I(i)+GY = C(Y) + I(i) + G): differentiating, the slope didYIS=1C(Y)I(i)<0\dfrac{di}{dY}\Big|_{IS} = \dfrac{1 - C'(Y)}{I'(i)} < 0 since I(i)<0I'(i) < 0 — downward sloping.

LM curve (money-market equilibrium M/P=L(Y,i)M/P = L(Y, i)): slope didYLM=LYLi>0\dfrac{di}{dY}\Big|_{LM} = -\dfrac{L_Y}{L_i} > 0 (since LY>0L_Y > 0, Li<0L_i < 0) — upward sloping.

Equilibrium identities: Y=C(Y)+I(i)+G0Y = C(Y) + I(i) + G_0 and M0P=L(Y,i)\dfrac{M_0}{P} = L(Y, i), solved for Y,iY^*, i^*. Comparative statics (e.g. Y/G0>0\partial Y^*/\partial G_0 > 0, Y/M0>0\partial Y^*/\partial M_0 > 0) follow by total differentiation and Cramer's rule.

OR — national-income model.

Differentials: dy=f(x)dxdy = f'(x)\,dx approximates the change in yy for a small change in xx. Point elasticity: ε=dy/ydx/x=xydydx\varepsilon = \dfrac{dy/y}{dx/x} = \dfrac{x}{y}\dfrac{dy}{dx}, the proportional responsiveness of yy to xx.

(a) S=dS/dYS' = dS/dY is the marginal propensity to save; T=dT/dYT' = dT/dY is the marginal tax rate; I=dI/dYI' = dI/dY is the marginal propensity to invest — each the change in that quantity per unit change in income.

(b) Let F(Y,G0)=S(Y)+T(Y)I(Y)G0=0F(Y, G_0) = S(Y) + T(Y) - I(Y) - G_0 = 0. FF is continuous with continuous partials, and FY=S+TI>0\dfrac{\partial F}{\partial Y} = S' + T' - I' > 0 (given S+T>IS' + T' > I'), which is nonzero. So the implicit-function theorem applies and the equilibrium identity S(Y)+T(Y)I(Y)+G0S(Y^*) + T(Y^*) \equiv I(Y^*) + G_0 defines Y=Y(G0)Y^* = Y^*(G_0).

(c) By the implicit-function rule,

dYdG0=F/G0F/Y=1S+TI=1S+TI>0.\frac{dY^*}{dG_0} = -\frac{\partial F/\partial G_0}{\partial F/\partial Y} = -\frac{-1}{S' + T' - I'} = \frac{1}{S' + T' - I'} > 0.

Implication: an increase in government expenditure raises equilibrium national income (the government-expenditure multiplier); its size is the reciprocal of (S+TI)(S' + T' - I') — larger leakages (saving, taxes) shrink the multiplier.

is-lm-modelcomparative-staticsimplicit-function-theorem
408.5Long answer10 marks

Formulate the wine storage problem and extract the maximization conditions for the problem. [2+8]

OR

Write the first-order and second-order conditions for extremum of more than two variables. Find the extreme values of Z=x13+3x1x3+2x2x223x32Z = -x_1^3 + 3x_1 x_3 + 2x_2 - x_2^2 - 3x_3^2. Check whether they are maxima or minima by the determinantal test. [4+6]

Wine storage problem. A merchant owns wine whose value grows with age as V(t)V(t) (a known increasing, concave function). Storage is costless but money has a discount rate rr. The present value of selling at time tt is

A(t)=V(t)ert.A(t) = V(t)e^{-rt}.

Maximize over tt: First-order condition dAdt=0\dfrac{dA}{dt} = 0:

V(t)ertrV(t)ert=0V(t)V(t)=r.V'(t)e^{-rt} - rV(t)e^{-rt} = 0 \Rightarrow \frac{V'(t)}{V(t)} = r.

Sell when the proportional growth rate of value equals the discount rate. Second-order condition for a maximum: d2Adt2<0\dfrac{d^2A}{dt^2} < 0 at tt^*, i.e. V(t)rV(t)<0V''(t) - rV'(t) < 0, ensuring A(t)A(t) is concave at the optimum.

OR — unconstrained extremum, Z=x13+3x1x3+2x2x223x32Z = -x_1^3 + 3x_1 x_3 + 2x_2 - x_2^2 - 3x_3^2.

FOC (set first partials =0= 0):

Z1=3x12+3x3=0x3=x12,Z_1 = -3x_1^2 + 3x_3 = 0 \Rightarrow x_3 = x_1^2, Z2=22x2=0x2=1,Z_2 = 2 - 2x_2 = 0 \Rightarrow x_2 = 1, Z3=3x16x3=0x1=2x3.Z_3 = 3x_1 - 6x_3 = 0 \Rightarrow x_1 = 2x_3.

From x3=x12x_3 = x_1^2 and x1=2x3x_1 = 2x_3: x1=2x12x1(12x1)=0x1=0x_1 = 2x_1^2 \Rightarrow x_1(1 - 2x_1) = 0 \Rightarrow x_1 = 0 or x1=12x_1 = \tfrac12.

  • x1=0x3=0x_1 = 0 \Rightarrow x_3 = 0: critical point (0,1,0)(0, 1, 0).
  • x1=12x3=14x_1 = \tfrac12 \Rightarrow x_3 = \tfrac14: critical point (12,1,14)(\tfrac12, 1, \tfrac14).

SOC (Hessian).

H=[6x103020306].H = \begin{bmatrix} -6x_1 & 0 & 3 \\ 0 & -2 & 0 \\ 3 & 0 & -6 \end{bmatrix}.

Leading principal minors for a maximum need signs ,+,-,+,-.

  • At (12,1,14)(\tfrac12, 1, \tfrac14): H1=6(12)=3<0|H_1| = -6(\tfrac12) = -3 < 0; H2=(3)(2)0=6>0|H_2| = (-3)(-2) - 0 = 6 > 0; H3=detH|H_3| = \det H. With 6x1=3-6x_1 = -3: det=3[(2)(6)0]0+3[0(2)(3)]=3(12)+3(6)=36+18=18<0\det = -3[(-2)(-6) - 0] - 0 + 3[0 - (-2)(3)] = -3(12) + 3(6) = -36 + 18 = -18 < 0. Signs ,+,-,+,-local maximum. Z=(12)3+3(12)(14)+2(1)123(14)2=18+38+21316=11161.0625Z = -(\tfrac12)^3 + 3(\tfrac12)(\tfrac14) + 2(1) - 1^2 - 3(\tfrac14)^2 = -\tfrac18 + \tfrac38 + 2 - 1 - \tfrac{3}{16} = 1\tfrac{1}{16} \approx 1.0625.
  • At (0,1,0)(0, 1, 0): H1=0|H_1| = 0, the determinantal test is inconclusive/fails the strict maximum signs; this point is a saddle (since the cubic term makes ZZ unbounded along x1x_1).
optimizationwine-storageextremum-conditions
408.6Long answer10 marks

A two-product firm faces the following demand and cost functions: Q1=402P1P2Q_1 = 40 - 2P_1 - P_2; Q2=35P1P2Q_2 = 35 - P_1 - P_2; C=Q12+2Q22+10C = Q_1^2 + 2Q_2^2 + 10.

(a) Find the output levels that satisfy the first-order condition for maximum profit. (b) Check the second-order sufficient condition. Can you conclude that this problem possesses a unique absolute maximum? (c) Find the maximum profit. [4+4+2]

Invert demand to get prices in terms of quantities. From Q1=402P1P2Q_1 = 40 - 2P_1 - P_2 and Q2=35P1P2Q_2 = 35 - P_1 - P_2: subtracting, Q1Q2=5P1P1=5Q1+Q2Q_1 - Q_2 = 5 - P_1 \Rightarrow P_1 = 5 - Q_1 + Q_2. Then P2=35P1Q2=35(5Q1+Q2)Q2=30+Q12Q2.P_2 = 35 - P_1 - Q_2 = 35 - (5 - Q_1 + Q_2) - Q_2 = 30 + Q_1 - 2Q_2.

Revenue R=P1Q1+P2Q2=(5Q1+Q2)Q1+(30+Q12Q2)Q2=5Q1Q12+2Q1Q2+30Q22Q22.R = P_1 Q_1 + P_2 Q_2 = (5 - Q_1 + Q_2)Q_1 + (30 + Q_1 - 2Q_2)Q_2 = 5Q_1 - Q_1^2 + 2Q_1Q_2 + 30Q_2 - 2Q_2^2.

Profit π=RC=5Q1Q12+2Q1Q2+30Q22Q22(Q12+2Q22+10)=5Q12Q12+2Q1Q2+30Q24Q2210.\pi = R - C = 5Q_1 - Q_1^2 + 2Q_1Q_2 + 30Q_2 - 2Q_2^2 - (Q_1^2 + 2Q_2^2 + 10) = 5Q_1 - 2Q_1^2 + 2Q_1Q_2 + 30Q_2 - 4Q_2^2 - 10.

(a) FOC:

π1=54Q1+2Q2=0,π2=30+2Q18Q2=0.\pi_1 = 5 - 4Q_1 + 2Q_2 = 0,\qquad \pi_2 = 30 + 2Q_1 - 8Q_2 = 0.

From the first, Q2=(4Q15)/2Q_2 = (4Q_1 - 5)/2. Substitute: 30+2Q184Q152=030+2Q116Q1+20=050=14Q1Q1=2573.571.30 + 2Q_1 - 8\cdot\frac{4Q_1 - 5}{2} = 0 \Rightarrow 30 + 2Q_1 - 16Q_1 + 20 = 0 \Rightarrow 50 = 14Q_1 \Rightarrow Q_1 = \tfrac{25}{7} \approx 3.571. Then Q2=4(25/7)52=100/735/72=65/72=65144.643.Q_2 = \tfrac{4(25/7) - 5}{2} = \tfrac{100/7 - 35/7}{2} = \tfrac{65/7}{2} = \tfrac{65}{14} \approx 4.643.

(b) SOC: Hessian H=[π11π12π21π22]=[4228].H = \begin{bmatrix} \pi_{11} & \pi_{12} \\ \pi_{21} & \pi_{22} \end{bmatrix} = \begin{bmatrix} -4 & 2 \\ 2 & -8 \end{bmatrix}. H1=4<0|H_1| = -4 < 0 and H2=(4)(8)4=28>0|H_2| = (-4)(-8) - 4 = 28 > 0. Signs ,+-,+ → negative definite, so the stationary point is a maximum. Because π\pi is a (globally) concave quadratic, this is the unique absolute maximum.

(c) π=5(257)2(257)2+2(257)(6514)+30(6514)4(6514)21017.85725.51+23.66+139.2986.221059.07.\pi^* = 5(\tfrac{25}{7}) - 2(\tfrac{25}{7})^2 + 2(\tfrac{25}{7})(\tfrac{65}{14}) + 30(\tfrac{65}{14}) - 4(\tfrac{65}{14})^2 - 10 \approx 17.857 - 25.51 + 23.66 + 139.29 - 86.22 - 10 \approx 59.07.

Maximum profit π59.1\pi^* \approx 59.1.

profit-maximizationmulti-product-firmsecond-order-conditions
408.7Long answer10 marks

(a) Find the extremum of the optimization problem z=xyz = xy, subject to x+y=6x + y = 6 using the Lagrange-multiplier method.

(b) Check the optimality of the program z=xyz = xy, subject to x+2y=2x + 2y = 2 using the bordered Hessian. [5+5]

(a) Lagrangian L=xy+λ(6xy)\mathcal{L} = xy + \lambda(6 - x - y).

Lx=yλ=0,Ly=xλ=0,Lλ=6xy=0.\mathcal{L}_x = y - \lambda = 0,\quad \mathcal{L}_y = x - \lambda = 0,\quad \mathcal{L}_\lambda = 6 - x - y = 0.

So x=y=λx = y = \lambda and x+y=6x=y=3x + y = 6 \Rightarrow x = y = 3, λ=3\lambda = 3. Extremum at (3,3)(3, 3) with z=9z^* = 9.

Bordered Hessian for (a): with g=x+yg = x + y, gx=gy=1g_x = g_y = 1, Lxx=0\mathcal{L}_{xx} = 0, Lyy=0\mathcal{L}_{yy} = 0, Lxy=1\mathcal{L}_{xy} = 1:

Hˉ=011101110=0(01)1(01)+1(10)=0+1+1=2>0.\bar H = \begin{vmatrix} 0 & 1 & 1 \\ 1 & 0 & 1 \\ 1 & 1 & 0 \end{vmatrix} = 0(0-1) - 1(0-1) + 1(1-0) = 0 + 1 + 1 = 2 > 0.

For a two-variable, one-constraint problem Hˉ>0|\bar H| > 0 indicates a maximum. So (3,3)(3,3) is a constrained maximum, z=9z^* = 9.

(b) z=xyz = xy s.t. x+2y=2x + 2y = 2. Lagrangian L=xy+λ(2x2y)\mathcal{L} = xy + \lambda(2 - x - 2y).

Lx=yλ=0, Ly=x2λ=0x=2λ, y=λ.\mathcal{L}_x = y - \lambda = 0,\ \mathcal{L}_y = x - 2\lambda = 0 \Rightarrow x = 2\lambda,\ y = \lambda.

Constraint: 2λ+2λ=2λ=122\lambda + 2\lambda = 2 \Rightarrow \lambda = \tfrac12, so x=1x = 1, y=12y = \tfrac12, z=12z^* = \tfrac12.

Bordered Hessian: gx=1g_x = 1, gy=2g_y = 2, Lxx=0\mathcal{L}_{xx} = 0, Lyy=0\mathcal{L}_{yy} = 0, Lxy=1\mathcal{L}_{xy} = 1:

Hˉ=012101210=0(01)1(02)+2(10)=0+2+2=4>0.\bar H = \begin{vmatrix} 0 & 1 & 2 \\ 1 & 0 & 1 \\ 2 & 1 & 0 \end{vmatrix} = 0(0-1) - 1(0-2) + 2(1-0) = 0 + 2 + 2 = 4 > 0.

Since Hˉ>0|\bar H| > 0, the stationary point (1,12)(1, \tfrac12) is a constrained maximum with z=12z^* = \tfrac12.

lagrange-multiplierbordered-hessianconstrained-optimization
408.8Long answer10 marks

State the Kuhn-Tucker sufficiency conditions for concave programming. Solve the following problem applying the Kuhn-Tucker conditions. [2+8]

Minimize C=(x14)2+(x24)2\text{Minimize } C = (x_1 - 4)^2 + (x_2 - 4)^2 subject to 2x1+3x26,3x12x212,x1,x20.\text{subject to } 2x_1 + 3x_2 \ge 6,\quad -3x_1 - 2x_2 \ge -12,\quad x_1, x_2 \ge 0.

OR

State and establish Roy's identity. Consider a consumer with utility U=xyU = xy facing budget BB at prices PxP_x, PyP_y. Does Roy's identity hold for: Maximize U=xyU = xy subject to Pxx+Pyy=BP_x x + P_y y = B? [5+5]

Kuhn-Tucker sufficiency. For a concave-programming problem (minimize a convex CC over a convex feasible set), if there exist multipliers λj0\lambda_j \ge 0 and a point xx^* satisfying the KT conditions — stationarity of the Lagrangian, primal feasibility, dual feasibility (λj0\lambda_j \ge 0), and complementary slackness (λj(constraint slack)=0\lambda_j \cdot (\text{constraint slack}) = 0) — then xx^* is a global optimum.

Solution. Minimize C=(x14)2+(x24)2C = (x_1 - 4)^2 + (x_2 - 4)^2. The unconstrained minimizer is (4,4)(4, 4). Check the constraints there:

  • 2(4)+3(4)=2062(4) + 3(4) = 20 \ge 6
  • 3(4)2(4)=2012-3(4) - 2(4) = -20 \ge -12? → 2012-20 \ge -12 is false, so 3x1+2x2123x_1 + 2x_2 \le 12 is violated.
  • x1,x20x_1, x_2 \ge 0

So the binding constraint is 3x1+2x2=123x_1 + 2x_2 = 12 (i.e. 3x12x2=12-3x_1 - 2x_2 = -12). Minimize the distance from (4,4)(4,4) to this line. Lagrangian (active constraint): C=μ(3x1+2x2)\nabla C = \mu \nabla(3x_1 + 2x_2):

2(x14)=3μ,2(x24)=2μ.2(x_1 - 4) = 3\mu,\quad 2(x_2 - 4) = 2\mu.

So x14=32μx_1 - 4 = \tfrac32\mu, x24=μx_2 - 4 = \mu. Substitute into 3x1+2x2=123x_1 + 2x_2 = 12: 3(4+32μ)+2(4+μ)=1212+92μ+8+2μ=12132μ=8μ=1613.3(4 + \tfrac32\mu) + 2(4 + \mu) = 12 \Rightarrow 12 + \tfrac92\mu + 8 + 2\mu = 12 \Rightarrow \tfrac{13}{2}\mu = -8 \Rightarrow \mu = -\tfrac{16}{13}. Then x1=4+32(1613)=42413=28132.154x_1 = 4 + \tfrac32(-\tfrac{16}{13}) = 4 - \tfrac{24}{13} = \tfrac{28}{13} \approx 2.154, x2=41613=36132.769.x_2 = 4 - \tfrac{16}{13} = \tfrac{36}{13} \approx 2.769. Both 0\ge 0 and the first constraint 2x1+3x2=56+10813=1641312.662x_1 + 3x_2 = \tfrac{56 + 108}{13} = \tfrac{164}{13} \approx 12.6 \ge 6 ✓. The KT conditions are satisfied (the convex objective gives a global minimum). Minimum C=(28134)2+(36134)2=(2413)2+(1613)2=576+256169=8321694.92.C = (\tfrac{28}{13} - 4)^2 + (\tfrac{36}{13} - 4)^2 = (\tfrac{-24}{13})^2 + (\tfrac{-16}{13})^2 = \tfrac{576 + 256}{169} = \tfrac{832}{169} \approx 4.92.

OR — Roy's identity. Roy's identity states that the Marshallian demand can be recovered from the indirect utility function V(Px,Py,B)V(P_x, P_y, B):

x=V/PxV/B,y=V/PyV/B.x^* = -\frac{\partial V/\partial P_x}{\partial V/\partial B},\qquad y^* = -\frac{\partial V/\partial P_y}{\partial V/\partial B}.

Establish: differentiating V=U(x(P,B),y(P,B))V = U(x^*(P,B), y^*(P,B)) and using the envelope theorem on the constrained problem gives V/Px=λx\partial V/\partial P_x = -\lambda x^* and V/B=λ\partial V/\partial B = \lambda, hence the ratio yields xx^*.

Check for U=xyU = xy, budget Pxx+Pyy=BP_x x + P_y y = B: the demands are x=B2Pxx^* = \dfrac{B}{2P_x}, y=B2Pyy^* = \dfrac{B}{2P_y}, and indirect utility V=xy=B24PxPyV = x^* y^* = \dfrac{B^2}{4 P_x P_y}.

VPx=B24Px2Py,VB=B2PxPy.\frac{\partial V}{\partial P_x} = -\frac{B^2}{4 P_x^2 P_y},\qquad \frac{\partial V}{\partial B} = \frac{B}{2 P_x P_y}. V/PxV/B=B2/(4Px2Py)B/(2PxPy)=B2/(4Px2Py)B/(2PxPy)=B2Px=x.-\frac{\partial V/\partial P_x}{\partial V/\partial B} = -\frac{-B^2/(4P_x^2 P_y)}{B/(2P_x P_y)} = \frac{B^2/(4P_x^2 P_y)}{B/(2P_x P_y)} = \frac{B}{2P_x} = x^*.

Similarly for yy^*. So Roy's identity holds.

kuhn-tuckernonlinear-programmingroys-identity
408.9Long answer10 marks

(a) Find the present value of a continuous revenue flow lasting for yy years at the constant rate of DD dollars per year and discounted at the rate of rr per year.

(b) Find the present value of a perpetual cash flow of: i. \1450peryear,discountedatper year, discounted atr = 5%.ii.. ii. $2460peryear,discountedatper year, discounted atr = 8%$. [5+5]

(a) With continuous discounting, the present value of a flow DD over [0,y][0, y] is

PV=0yDertdt=D[ertr]0y=Dr(1ery).PV = \int_0^y D\,e^{-rt}\,dt = D\left[\frac{-e^{-rt}}{r}\right]_0^y = \frac{D}{r}\left(1 - e^{-ry}\right).

(b) For a perpetual (infinite-horizon) flow, yy \to \infty gives PV=DrPV = \dfrac{D}{r}.

  • i. D=1450D = 1450, r=0.05r = 0.05: PV = \dfrac{1450}{0.05} = \29{,}000.$
  • ii. D=2460D = 2460, r=0.08r = 0.08: PV = \dfrac{2460}{0.08} = \30{,}750.$
present-valuecontinuous-discountingperpetuity
408.10Long answer10 marks

Write the basic premises of Domar's growth model and extract the solution to the model. [4+6]

OR

Let the demand and supply functions be Qd=402P2PPQ_d = 40 - 2P - 2P' - P'', Qs=5+3PQ_s = -5 + 3P, with P(0)=12P(0) = 12 and P(0)=1P'(0) = 1. (a) Find the price path, assuming market clearance at every point of time. (b) Is the time path convergent? Mention its fluctuation.

Domar growth model — premises.

  1. Investment I(t)I(t) has a dual role: it creates demand (Keynesian multiplier) and adds to productive capacity (capital accumulation).
  2. The economy starts in full-capacity equilibrium.
  3. Constant marginal propensity to save ss and constant capacity-capital ratio ρ\rho (potential output per unit capital).

Demand side: dYddt=1sdIdt\dfrac{dY_d}{dt} = \dfrac{1}{s}\dfrac{dI}{dt}. Supply side: dYsdt=ρI\dfrac{dY_s}{dt} = \rho I. For equilibrium growth, dYddt=dYsdt\dfrac{dY_d}{dt} = \dfrac{dY_s}{dt}:

1sdIdt=ρI1IdIdt=ρs.\frac{1}{s}\frac{dI}{dt} = \rho I \Rightarrow \frac{1}{I}\frac{dI}{dt} = \rho s.

Solving, I(t)=I0eρstI(t) = I_0 e^{\rho s\, t} — investment (and hence income/output) must grow at the required rate ρs\rho s to keep capacity fully utilized.

OR — market dynamics. Market clearance Qd=QsQ_d = Q_s:

402P2PP=5+3PP+2P+5P=45.40 - 2P - 2P' - P'' = -5 + 3P \Rightarrow P'' + 2P' + 5P = 45.

Particular (equilibrium): Pp=45/5=9P_p = 45/5 = 9.

Complementary: roots of m2+2m+5=0m=2±4202=1±2i.m^2 + 2m + 5 = 0 \Rightarrow m = \dfrac{-2 \pm \sqrt{4 - 20}}{2} = -1 \pm 2i. Complex with negative real part, so

P(t)=9+et(Acos2t+Bsin2t).P(t) = 9 + e^{-t}\left(A\cos 2t + B\sin 2t\right).

Initial conditions: P(0)=129+A=12A=3.P(0) = 12 \Rightarrow 9 + A = 12 \Rightarrow A = 3. P(t)=et[(A+2B)cos2t+(B2A)sin2t]P'(t) = e^{-t}\big[(-A + 2B)\cos 2t + (-B - 2A)\sin 2t\big]; P(0)=A+2B=13+2B=1B=2.P'(0) = -A + 2B = 1 \Rightarrow -3 + 2B = 1 \Rightarrow B = 2.

P(t)=9+et(3cos2t+2sin2t).\boxed{P(t) = 9 + e^{-t}\left(3\cos 2t + 2\sin 2t\right).}

(b) The real part of the roots is 1<0-1 < 0, so the oscillations are damped and P(t)9P(t) \to 9 as tt \to \infty. The time path is convergent, exhibiting damped (decaying) fluctuations about the equilibrium price 99.

domar-growth-modelmarket-dynamicsdifferential-equations

Frequently asked questions

Where can I find the BSc CSIT (TU) B.Sc. Mathematics 407 & 408 (Model) question paper 2079?
The full BSc CSIT (TU) B.Sc. Mathematics 407 & 408 (Model) 2079 (Model questions) question paper is available free on Kekkei. You can read every question online and attempt the paper under timed exam conditions.
Does the B.Sc. Mathematics 407 & 408 (Model) 2079 paper come with solutions?
Yes. Every question on this B.Sc. Mathematics 407 & 408 (Model) past paper includes a step-by-step solution, plus instant AI feedback when you attempt it on Kekkei.
How many marks is the BSc CSIT (TU) B.Sc. Mathematics 407 & 408 (Model) 2079 paper?
The BSc CSIT (TU) B.Sc. Mathematics 407 & 408 (Model) 2079 paper carries 100 full marks and is meant to be completed in 180 minutes, across 20 questions.
Is practising this B.Sc. Mathematics 407 & 408 (Model) past paper free?
Yes — reading and attempting this B.Sc. Mathematics 407 & 408 (Model) past paper on Kekkei is completely free.